Reoviridae

In Virus Taxonomy, 2012

Genome organization and replication

The coding strand of each dsRNA has a single ORF, except for Seg11 and Seg12 of RDV ( Table 28), Seg9 of rice gall dwarf virus (RGDV) and Seg9 of WTV. RDV Seg11 has two in-frame initiation codons, thus resulting in two ORFs. RDV Seg12, RGDV Seg9 and WTV Seg9 possess a second, small out-of-frame and over-lapping ORF, downstream within the major ORF. No evidence has yet been obtained for the expression of this second ORF. Five structural and five NS WTV proteins have been assigned to their respective genome segments. RDV Seg1 encodes the putative transcriptase. Genus-specific and segment-specific sequence motifs appear to be necessary for successful replication, translation and encapsidation. Laboratory strains having internal deletions in some segments, but intact termini, replicate and compete favorably with wild-type virus, although the proteins expressed are aberrant, and the ability of the viruses to be transmitted by vectors may be lost. Virus replication occurs in the cytoplasm of infected cells in association with viroplasms. WTV and RGDV are confined to phloem tissues of the plant host, whereas RDV can also multiply elsewhere.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123846846000513

DNA Repair

C.G. Cupples , in Encyclopedia of Microbiology (Third Edition), 2009

Transcription-Coupled NER

DNA damage in the coding strand of actively transcribed genes is repaired preferentially, a process known as transcription-coupled NER (TC-NER). The initiating signal is the blockage of RNA polymerase by the DNA lesion. In E. coli, the stalled polymerase attracts the transcription repair coupling factor (TRCF), product of the mfd gene (mutation frequency decline). TRCF displaces both the polymerase and the incomplete mRNA transcript and recruits the (UvrA)2UvrB complex to the damage site. There is some evidence that the MMR proteins MutS and MutL are involved in TC-NER, but the mechanism is unknown. TC-NER also occurs in eukaryotic cells, where it requires the basic NER proteins, plus additional factors, CSA and CSB (Rad26 in yeast).

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123739445000705

Gene Expression: Transcription of the Genetic Code

Chang-Hui Shen , in Diagnostic Molecular Biology, 2019

Coding Strand

The other strand is called the coding strand, because its sequence is the same as the RNA sequence that is produced, with the exception of U replacing T. It is also called sense strand, because the RNA sequence is the sequence that we use to determine what amino acids are produced through mRNA. It is also called (+) strand, or nontemplate strand. As the RNA polymerase moves along the template strand in 3′→  5′ direction, the RNA chain grows in 5′→   3′ direction. The nucleotide at the 5′ end of the chain retains its triphosphate group. Unlike DNA replication, a primer is not needed in RNA synthesis. The RNA synthesized by the RNA polymerase is, therefore, named messenger RNA (mRNA) for its role in carrying a copy of the genetic information to the ribosome.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780128028230000031

Endornaviridae

In Virus Taxonomy, 2012

Genome organization and replication

Each characterized genome encodes a single long polypeptide that crosses the break in the coding strand. These polypeptides include aa sequences typical of viral RNA helicases (Hels), UDP-glucosyltransferases (UGTs) and RNA-dependent RNA polymerases (RdRps). The polypeptides of Oryza sativa endornavirus (OsEV), Oryza rufipogon endornavirus (OrEV) and Phytophthora endornavirus 1 (PEV1) are about 4600 aa residues long, and those of Helicobasidium mompa endornavirus 1 (HmEV1) and Vicia faba endornavirus (VfEV) are about 5500 aa residues long. RNA replication occurs in cytoplasmic vesicles where RdRp activity has been detected in association with the genomic dsRNA. The cytoplasmic vesicles, sometimes called "virus-like particles," are bounded by a unit membrane and are believed to be functionally equivalent to the replication complexes of positive strand RNA viruses. Endornavirus RNA has been found in every tissue and at every developmental stage and is maintained at an almost constant concentration (20–100 copies/cell) except in the pollen of some species.

Figure 1. A genome map for an isolate of Oryza sativa endornavirus. A triangle marks the position of the break in the coding strand (1221 nucleotide from the 5′ end of the coding strand). Hel, UGT and RdRp indicate the positions of viral RNA helicase, UDP-glucosyltransferase and RNA-dependent RNA polymerase domains, respectively.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123846846000483

Branched-Chain Amino Acids, Part B

Natalia Y. Kedishvili , ... Robert A. Harris , in Methods in Enzymology, 2000

Procedure Used to Obtain 5′ Coding Region of Methylmalonate-semialdehyde Dehydrogenase cDNA

In this procedure, 3 a specific primer is designed to hybridize to bases 145–177 of the coding strand of the rat cDNA: oligo 1 (GAAAGAAGAT-GCTGGATACCATGTGGAGTTTAC). External primers (one for each insert orientation) are synthesized to correspond to bases 4266–4288 (GGTGGCGACGACTCCGGAGCCCG) and bases 4323–4352 (TTGA-CACCAGACCAACTGGTAATGGTAGCG) of the Escherichia coli lactose operon flanking the EcoRI insertion site in λgt11 (primers L and R, respectively). Phage DNA from 1   ml of amplified cDNA library (Clontech Laboratories) stock (titer, 1010 PFU/ml) is purified by conventional techniques 10 and used as a template for PCR. Each reaction mixture consists of specific primer, one external primer, and 300–500   ng of purified phage DNA along with deoxynucleoside triphosphates, buffer, and Taq polymerase, as per the manufacturer instructions (GeneAmp; Perkin-Elmer Cetus). Template is denatured at 94º for 1   min, primers are annealed at 55º for 1   min, and chains are polymerized at 72º for 2   min for 35 cycles with a 7-min extension at 72º added to the final cycle. A PCR product is found to hybridize specifically to a 27-bp internal oligonucleotide corresponding to bases 118–144 (TTTAGAAGAAACCTGCAGGATCCGGGC) of the rat cDNA. The band is subcloned and sequenced.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/S007668790024233X

Endornavirus

T. Fukuhara , H. Moriyama , in Encyclopedia of Virology (Third Edition), 2008

Site-Specific Nick in the Coding Strand

All five endornaviruses that have been sequenced completely contain a site-specific nick in the 5′ region of the coding strand, which divides not only the coding strand but also the single long ORF ( Figure 1 ). The biological implications of the nick remain unknown. However, it must affect at least two important steps in the life cycle of the endornavirus, because the divided coding strand can no longer be used as either a template for noncoding strand synthesis or an mRNA for translation of the putative polyprotein. The molecular mechanism that generates the nick is also unknown: an unknown endonuclease encoded by either the host genome or the endornavirus itself might cleave the coding strand site specifically. These two molecular features, the single long ORF and the site-specific nick, are unique, and have never been found in other known RNA viruses.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B978012374410400580X

Short Tandem Repeat (STR) Loci and Kits

John M. Butler , in Advanced Topics in Forensic DNA Typing: Methodology, 2012

Choice of the Strand

•

For STRs within protein coding regions (as well as in the intron of the genes), the coding strand should be used. This would apply to STRs such as vWA (GenBank: M25716), TPOX (GenBank: M68651), and CSF1PO (GenBank: X14720).

•

For repetitive sequences without any connection to protein coding genes like many of the D#S### loci, the sequence originally described in the literature of the first public database entry shall become the standard reference (and strand) for nomenclature. Examples here include D18S51 (GenBank: L18333) and D21S11 (GenBank: M84567).

•

If the nomenclature is already established in the forensic field but not in accordance with the aforementioned guideline, the nomenclature shall be maintained to avoid unnecessary confusion. This recommendation applies to the continued use by some laboratories of the "AATG repeat" strand for the STR marker TH01. The GenBank sequence for TH01 uses the coding strand and therefore contains the complementary "TCAT repeat" instead.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123745132000051

Viral Haemorrhagic Fevers

In Perspectives in Medical Virology, 2005

Genetic organisation and gene expression

The flavivirus genome is an approximately 11 kb RNA molecule of positive sense 2 with respect to protein translation. The 5′ end of the genome possess a type I cap (m-7GpppAmp) followed by the conserved dinucleotide AG. Flavivirus genomes are the only positive stranded RNA viruses of mammals that do not possess a poly(A) tract at the 3′ end: the 3′ terminus ends with the conserved dinucleotide CU. While nucleotide sequences are divergent amongst members of the flavivirus genus, the secondary structures at the 5′ and 3′ ends are conserved among mosquito-borne and tick-borne members of the genus.

In common with the picornaviruses, the viral genes are first expressed by synthesis of a large polyprotein (Fig. 4). This single precursor molecule then undergoes a series of cleavages thereby generating functional proteins. Cleavages are mediated either by the host signal peptidase present in the lumen of the endoplasmic reticulum or by a viral serine protease. The 5′ and 3′ ends of the genome are not translated, the secondary structure in this region having a role in mediating genome replication.

Fig. 4. Organisation of the yellow fever genome.

Gene expression starts by ribosomes binding to a site downstream from the 5′ terminus, bypassing several AUG initiation codons before recognising a site close to the AUG located immediately upstream of the capsid, C gene. This internal ribosome entry event required for translating the viral genome is common to both flaviviruses and picornaviruses: the internal ribosome binding entry site (IRES) is formed in part by the secondary structure of the 5′ non-translated region.

A total of 10 proteins are expressed as a result of the processing of the polyprotein precursor. The three structural proteins, capsid (C), membrane (prM/M) and envelope (E) are expressed at the 5′ end, followed by the genes coding for the non-structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5 (Fig. 4). Polyprotein processing confers the advantage that gene expression can be controlled by the rate and extent to which these cleavage events occur. In addition, the use of alternative cleavage sites results in proteins with stretches of amino acid homology but different functions. This form of viral protein synthesis is likely inefficient, however, with some gene products being produced surplus to the requirements of virus replication.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/S0168706905800035

Regulation at the RNA Level

David P. Clark , Nanette J. Pazdernik , in Molecular Biology (Second Edition), 2013

1.5 Translation May Be Regulated by Antisense RNA

Messenger RNA is transcribed using only one DNA strand as the template. This is referred to variously as the template strand, non-coding strand, or antisense strand. The mRNA produced is consequently sense RNA. The other strand of DNA (the coding strand or sense strand) is not normally used as a template for transcription. If RNA were transcribed using the coding strand as a template we would produce an RNA molecule complementary in sequence to the original mRNA. This is known as antisense RNA and can base pair with its complementary mRNA, just as the two strands of DNA in the original gene base pair with each other (Fig. 18.08). (Note that uracil pairs with adenine in duplex RNA.)

Figure 18.08. Antisense RNA can Base Pair with mRNA

mRNA is normally made using the non-coding strand of DNA as a template. Such mRNA is also known as sense RNA. If RNA is made using the coding strand as a template, it will be complementary in sequence to mRNA and is known as antisense RNA. The sense and antisense strands of RNA can base pair.

Antisense RNA binds to mRNA and prevents its translation.

Tcherkezian J, Brittis PA, Thomas F, Roux PP, Flanagan JG (2010) Transmembrane receptor DCC associates with protein synthesis machinery and regulates translation. Cell 141:632–644.

Focus on Relevant Research

This article describes the specific association of a transmembrane protein, DCC, with ribosomal subunits and initiation factors. DCC is found in the cytoplasmic membrane of nerve cells where it receives signals from outside. The nerve cell body, containing the nucleus, is separated from the axon terminus by an axon. Many neurons have long thin axons that can be meters in length. How the nucleus maintains control at such distances is explained by axonal transport proteins that move up and down axon filaments with protein cargo. But this does not fully explain rapid axon growth during development, which requires massive protein synthesis. Movement of all these components so far seems too difficult for a quick and accurate assembly.

This paper first explores the location of the translation machinery and DCC. Ribosome subunit S6, translation initiation factor, eIF4E, and DCC were shown to overlap when antibodies to these proteins were visualized by fluorescence microscopy suggesting that ribosomes are found associated with DCC at the cytoplasmic membrane. Electron microscopy and immunoprecipitation experiments support this idea. The authors confirmed these associations by density gradient centrifugation of ribosomal components followed by identification of proteins in the various subunit fractions. Interestingly, DCC was found with individual ribosomes but not with polysomes. Further, when the extracellular ligand netrin binds to DCC the ribosomes are released from DCC. Netrin is known to stimulate protein synthesis, and its release of ribosomes from DCC may be one mechanism for this.

Finally, the paper addresses the functional significance of DCC associating with ribosomes. Their results suggest that this interaction is essential for axonal outgrowth from the neural cell body. Furthermore, the location of DCC in dendrites corresponds to active protein translation as determined by incorporation of labeled amino acid analogs.

Antisense RNA is occasionally used in gene regulation both by bacteria and eukaryotes. If antisense RNA is made, it will base pair with the mRNA and prevent it from being translated. In practice, antisense RNA can be made by transcribing the wrong strand of the gene, or by transcribing an entirely different gene with complementary sequences to the one it regulates. When the wrong strand of the gene is transcribed, the antisense RNA is a perfect match, whereas when a separate "antisense gene" is transcribed, the sense/antisense pair may only be partially complementary.

Antisense RNA works by a variety of mechanisms to control gene expression. Some antisense transcripts induce conformational changes in their target RNA. One example is the control of replication of a staphylococcal plasmid. Here, the antisense RNA (RNAIII) binds to repR RNA and creates a terminator stem loop that causes RNA polymerase to fall off. This is unusual for antisense control because it blocks transcription rather than translation. The more common mechanism of antisense control is to block translation. For example, tisB RNA (encoding a toxic peptide in E. coli) is transcribed until its antisense partner, IstR-1, binds to its 5′-UTR far upstream from the ribosome-binding site. This creates a double-stranded region of RNA that is cut by ribonuclease III, thus destroying the mRNA. By far the most common antisense mechanism is preventing ribosomes from initiating translation by physically blocking the ribosome-binding site. Some less common antisense RNA activities are the activation of translation by inducing the cutting of a polycistronic message into two different transcripts. This cleavage exposes a second ribosome-binding site on the downstream gene and enhances its translation.

Bacterioferritin is the protein used by bacteria to store surplus iron atoms. The bfr gene encodes bacterioferritin itself and the anti-bfr gene encodes the antisense RNA (Fig. 18.09). Since only a relatively short piece of antisense RNA is needed to block the mRNA, the anti-gene is similar in sequence but shorter than the original gene. When the iron concentration in the culture medium is low, bacterioferritin is not needed, but it is made if the iron level goes up. The bfr gene itself is transcribed to give mRNA whether there is iron or not.

Figure 18.09. Antisense RNA Regulates Bacterioferritin Synthesis

The bacterial chromosome contains genes for both bfr mRNA and anti-bfr RNA. If both RNA molecules are transcribed the anti-bfr RNA pairs with the bfr mRNA and prevents it from being translated. When iron is plentiful the anti-bfr gene is not expressed and only the bfr mRNA is produced. Under these conditions translation of the bfr mRNA to give bacterioferritin can take place.

The anti-bfr gene is controlled by a regulatory protein known as Fur (ferric uptake regulator), which senses iron levels. When plenty of iron is present, Fur acts as a repressor and turns off the transcription of a dozen or more operons needed for adapting the cell to iron scarcity. These include genes for several iron uptake systems designed to capture trace levels of this essential nutrient. In addition, Fur plus iron turns off the anti-bfr gene, which turns on the production of bacterioferritin. In low iron, the anti-bfr gene is transcribed to give antisense RNA. This prevents synthesis of the bacterioferritin protein when iron is scarce. The anti-bfr gene is now known to control several genes and has been renamed ryhB. Thus, by using antisense RNA, several genes can be regulated the opposite way to a group of others, although all respond to the same stimulus.

Artificially-synthesized antisense RNA will interfere with gene expression or any other cell process involving RNA. For example, antisense RNA is being tested experimentally to suppress cancer growth by stopping chromosome division. Antisense therapy is also used to treat retinitis due to cytomegalovirus (CMV). CMV is normally present in almost everyone, but when the person's immune system is compromised due to organ transplantation or AIDS, then the virus is activated. The virus attacks the retina and eventually will cause blindness if left untreated. The antisense therapy prevents the virus from replicating and thus damaging the retina.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123785947000184

Gene Probes

A. Giaid , ... J.M. Polak , in Methods in Neurosciences, 1989

Control Experiments

Control experiments are very important in assessing the specificity of the hybridization and should include the following.

1.

Sense probes: Probes identical to the coding strand of the mRNA under investigation are transcribed and hybridized as above. These are used as negative controls.

2.

Ribonuclease treatment: Sections are treated with RNase A (20 µg/ml 37°C, 30 min) before the prehybridization step.

3.

Inappropriate probe for the tissue in question.

4.

Inappropriate tissue for the probe in question.

5.

Northern blot analysis: The presence of the particular mRNA in the tissue may be confirmed by Northern blot hybridization.

6.

Several probes, coding for different regions of the same gene.

7.

Immunocytochemistry: The correlation of immunocytochemical results with those obtained by in situ hybridization can be a useful indication of the specificity of the signal.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780121852511500131